View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5492_low_32 (Length: 328)
Name: NF5492_low_32
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5492_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 47425783 - 47425598
Alignment:
| Q |
1 |
gtgatttttgtttggtgttgttgtggagtagtgatttaatacattgcaggggtaatatgtctttgaatgtgaggggttggttaggggctttatattcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425783 |
gtgatttttgtttggtgttgttgtggagtagtgatttaatacattgcaggggtaatatgtctttgaatgtgaggggttggttaggggctttatattcacc |
47425684 |
T |
|
| Q |
101 |
accctacgatgtttttctatttttggcttgatgttcttgcaatttgtttaagccatgggtccatggcctttactgggctaaaacaaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425683 |
accctacgatgtttttctatttttggcttgatgttcttgcaa-ttgtttaagccatgggtccatggcctttactgggctaaaacaaa |
47425598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 212 - 310
Target Start/End: Complemental strand, 47425541 - 47425443
Alignment:
| Q |
212 |
gtgttttctatgacatgatttgaattctattggtcatgtggttctaaatgttttagtagtacaaataatcatgaaatgaatcgatgcctataacctaat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425541 |
gtgttttctatgacatgatttgaattctattggtcatgtggttctaaatgttttagtagtacaaataatcatgaaatgaatcgatgcctataacctaat |
47425443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University