View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5492_low_36 (Length: 312)
Name: NF5492_low_36
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5492_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 151 - 291
Target Start/End: Complemental strand, 38177376 - 38177236
Alignment:
| Q |
151 |
aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38177376 |
aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgc |
38177277 |
T |
|
| Q |
251 |
atatggaaatttaatagtcagggagtttatacggtaaagtc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38177276 |
atatggaaatttaatagtcagggagtttatacggtaaagtc |
38177236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 18978452 - 18978257
Alignment:
| Q |
14 |
agatggagaattggaaatggaaagagcataacggtgtgggcagatccgtggctgagggaggatgaaaattcgtatgtctctagtgaaaaaattcaaggca |
113 |
Q |
| |
|
|||||| |||| | |||||| ||||| || |||||||| |||||| |||||| ||||| ||||| ||||||||||| | || |||||| | ||||| |
|
|
| T |
18978452 |
agatggtgaatcgaaaatggtaagagtattgcggtgtggacagatctgtggctaagggaagatgagaattcgtatgttacaagcgaaaaa-tccaaggtt |
18978354 |
T |
|
| Q |
114 |
tggaaagaatgaaggtagcagatttgatgagtggagaaaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatc |
210 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |||||||||| |||| |||| ||||||||||| || || ||||| || ||||| |
|
|
| T |
18978353 |
tggaaaatatgaaggttgcagatttgatgagtggagaaagctggaattgggggatgatagcagggatttttaatgatcatgacaggaaagcgatatc |
18978257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 210
Target Start/End: Original strand, 34211722 - 34211808
Alignment:
| Q |
124 |
gaaggtagcagatttgatgagtggagaaaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatc |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||| |||| |||| ||||||||||| || |||||||| || ||||| |
|
|
| T |
34211722 |
gaaggttgcagatttgatgagtggagaaagctggaattgggggatgatagcagggatttttaatgatcatgataggaaagcgatatc |
34211808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 34211657 - 34211721
Alignment:
| Q |
14 |
agatggagaattggaaatggaaagagcataacggtgtgggcagatccgtggctgagggaggatga |
78 |
Q |
| |
|
|||||| ||||||||||||| ||||| || |||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
34211657 |
agatggcgaattggaaatggtaagagtattgcggtgtggacagatccgtggctaagggaagatga |
34211721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University