View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5492_low_36 (Length: 312)

Name: NF5492_low_36
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5492_low_36
NF5492_low_36
[»] chr7 (1 HSPs)
chr7 (151-291)||(38177236-38177376)
[»] chr2 (3 HSPs)
chr2 (14-210)||(18978257-18978452)
chr2 (124-210)||(34211722-34211808)
chr2 (14-78)||(34211657-34211721)


Alignment Details
Target: chr7 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 151 - 291
Target Start/End: Complemental strand, 38177376 - 38177236
Alignment:
151 aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgc 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38177376 aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgc 38177277  T
251 atatggaaatttaatagtcagggagtttatacggtaaagtc 291  Q
    |||||||||||||||||||||||||||||||||||||||||    
38177276 atatggaaatttaatagtcagggagtttatacggtaaagtc 38177236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 18978452 - 18978257
Alignment:
14 agatggagaattggaaatggaaagagcataacggtgtgggcagatccgtggctgagggaggatgaaaattcgtatgtctctagtgaaaaaattcaaggca 113  Q
    |||||| |||| | |||||| ||||| ||  |||||||| |||||| |||||| ||||| ||||| |||||||||||  | || |||||| | |||||      
18978452 agatggtgaatcgaaaatggtaagagtattgcggtgtggacagatctgtggctaagggaagatgagaattcgtatgttacaagcgaaaaa-tccaaggtt 18978354  T
114 tggaaagaatgaaggtagcagatttgatgagtggagaaaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatc 210  Q
    ||||||  |||||||| ||||||||||||||||||||||  ||||||||||   |||| ||||  ||||||||||| || || ||||| || |||||    
18978353 tggaaaatatgaaggttgcagatttgatgagtggagaaagctggaattgggggatgatagcagggatttttaatgatcatgacaggaaagcgatatc 18978257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 210
Target Start/End: Original strand, 34211722 - 34211808
Alignment:
124 gaaggtagcagatttgatgagtggagaaaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatc 210  Q
    |||||| ||||||||||||||||||||||  ||||||||||   |||| ||||  ||||||||||| || |||||||| || |||||    
34211722 gaaggttgcagatttgatgagtggagaaagctggaattgggggatgatagcagggatttttaatgatcatgataggaaagcgatatc 34211808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 34211657 - 34211721
Alignment:
14 agatggagaattggaaatggaaagagcataacggtgtgggcagatccgtggctgagggaggatga 78  Q
    |||||| ||||||||||||| ||||| ||  |||||||| ||||||||||||| ||||| |||||    
34211657 agatggcgaattggaaatggtaagagtattgcggtgtggacagatccgtggctaagggaagatga 34211721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University