View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5492_low_40 (Length: 292)
Name: NF5492_low_40
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5492_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 28118948 - 28119222
Alignment:
| Q |
1 |
tacaaacactaccttaattctttactttcaatttttccttcatagatcatatgactctcacaaatttaatcaaaccctagnnnnnnnaaacctaattatt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28118948 |
tacaaacactaccttaattctttcctttcaatttttccttcatagatcatatgactctcacaaatttaatcaaaccctagtttttttaaacctaattatt |
28119047 |
T |
|
| Q |
101 |
acatctnnnnnnnnnccatagctatagacattnnnnnnnnnnnnnnnntattaattaccctttagagatgagtctaaactctagtggcagcggaagcagt |
200 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28119048 |
acatctaaaaaaaa-ccatagctatagacattaaaacaaaaacaaaaatattaattaccctttagagatgagtctaaactctagtggcagcggaagcggt |
28119146 |
T |
|
| Q |
201 |
ggtggcggcggaagcagtggaagcccttgtggggcttgcaagtttttgaggaggaagtgtgtgcaagggtgtgttt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119147 |
ggtggcggcggaagcagtggaagcccttgtggggcttgcaagtttttgaggaggaagtgtgtgcaagggtgtgttt |
28119222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 262
Target Start/End: Original strand, 13286790 - 13286827
Alignment:
| Q |
225 |
ccttgtggggcttgcaagtttttgaggaggaagtgtgt |
262 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
13286790 |
ccttgtggtgcttgcaagtttttgaggagaaagtgtgt |
13286827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University