View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5492_low_43 (Length: 290)

Name: NF5492_low_43
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5492_low_43
NF5492_low_43
[»] chr4 (2 HSPs)
chr4 (1-149)||(48412301-48412449)
chr4 (224-284)||(48412525-48412585)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 48412301 - 48412449
Alignment:
1 aattgcgagtgagagtgctagaatcagagcctttggaatctggtggaatacctctggttcgaagtgagcgtctgataacaattggggtttcggttttggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48412301 aattgcgagtgagagtgctagaatcagagcctttggaatctggtggaatacctctggttcgaagtgagcgtctgataacaattggggtttcggttttggg 48412400  T
101 ttttttctctgatttcacgctatacgatttggtaacggccctgtcaatt 149  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||    
48412401 ttttttctcagatttcacgctatacgatttggtaacggccctgtcaatt 48412449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 48412525 - 48412585
Alignment:
224 acttgggacgaatggagagttcggtggctttagtgtgaactttgagagcggccatcatttc 284  Q
    |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||    
48412525 acttgggaagaatggagagttcggtggctttagtgtgaactttaagagcggccatcatttc 48412585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University