View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5492_low_43 (Length: 290)
Name: NF5492_low_43
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5492_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 48412301 - 48412449
Alignment:
| Q |
1 |
aattgcgagtgagagtgctagaatcagagcctttggaatctggtggaatacctctggttcgaagtgagcgtctgataacaattggggtttcggttttggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412301 |
aattgcgagtgagagtgctagaatcagagcctttggaatctggtggaatacctctggttcgaagtgagcgtctgataacaattggggtttcggttttggg |
48412400 |
T |
 |
| Q |
101 |
ttttttctctgatttcacgctatacgatttggtaacggccctgtcaatt |
149 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412401 |
ttttttctcagatttcacgctatacgatttggtaacggccctgtcaatt |
48412449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 48412525 - 48412585
Alignment:
| Q |
224 |
acttgggacgaatggagagttcggtggctttagtgtgaactttgagagcggccatcatttc |
284 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48412525 |
acttgggaagaatggagagttcggtggctttagtgtgaactttaagagcggccatcatttc |
48412585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University