View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5492_low_72 (Length: 205)

Name: NF5492_low_72
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5492_low_72
NF5492_low_72
[»] chr8 (2 HSPs)
chr8 (2-81)||(3497272-3497351)
chr8 (7-79)||(14391019-14391094)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 3497351 - 3497272
Alignment:
2 ggaacgttgcttgatggtacgaagtttgattctagcagagataggggaactactttcaatttcacgcttggacaaggtca 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3497351 ggaacgttgcttgatggtacgaagtttgattctagcagagataggggaactactttcaatttcacgcttggacaaggtca 3497272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 14391094 - 14391019
Alignment:
7 gttgcttgatggtacgaagtttgattctagcagagataggggaac---tactttcaatttcacgcttggacaaggt 79  Q
    |||||||||||||| ||||||||| |||||||| || || |||||   ||| |||| |||||||||||||| ||||    
14391094 gttgcttgatggtaagaagtttgactctagcagcgacagaggaacaagtaccttcagtttcacgcttggacgaggt 14391019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University