View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5492_low_72 (Length: 205)
Name: NF5492_low_72
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5492_low_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 3497351 - 3497272
Alignment:
| Q |
2 |
ggaacgttgcttgatggtacgaagtttgattctagcagagataggggaactactttcaatttcacgcttggacaaggtca |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497351 |
ggaacgttgcttgatggtacgaagtttgattctagcagagataggggaactactttcaatttcacgcttggacaaggtca |
3497272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 14391094 - 14391019
Alignment:
| Q |
7 |
gttgcttgatggtacgaagtttgattctagcagagataggggaac---tactttcaatttcacgcttggacaaggt |
79 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| || || ||||| ||| |||| |||||||||||||| |||| |
|
|
| T |
14391094 |
gttgcttgatggtaagaagtttgactctagcagcgacagaggaacaagtaccttcagtttcacgcttggacgaggt |
14391019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University