View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5493-Insertion-4 (Length: 135)
Name: NF5493-Insertion-4
Description: NF5493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5493-Insertion-4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 2e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 27446299 - 27446226
Alignment:
| Q |
7 |
aaaaagaaaaggagattgtgatactttacatttcttatgtttgaaagatttaaattatattttatcctttaattt |
81 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27446299 |
aaaaagaaaaggaaattgtgatattttacatttcttatgtttgaaaga-ttaaattatattttatcctttaattt |
27446226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 79 - 127
Target Start/End: Complemental strand, 27445988 - 27445940
Alignment:
| Q |
79 |
tttggtggagtgtagaagttacacattcactggtatgtatccggtctca |
127 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27445988 |
tttggtgaagtgtagaagttacacattcactggtatgtatccggtctca |
27445940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 79 - 120
Target Start/End: Complemental strand, 7079 - 7038
Alignment:
| Q |
79 |
tttggtggagtgtagaagttacacattcactggtatgtatcc |
120 |
Q |
| |
|
||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
7079 |
tttggtgaagtgtagcagctacacattcactggtatgtatcc |
7038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University