View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5493-Insertion-5 (Length: 110)
Name: NF5493-Insertion-5
Description: NF5493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5493-Insertion-5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 64 - 97
Target Start/End: Original strand, 1349953 - 1349986
Alignment:
| Q |
64 |
ttcaagtagaagtgtgttttacttgtgaactaag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1349953 |
ttcaagtagaagtgtgttttacttgtgaactaag |
1349986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University