View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5493_high_2 (Length: 429)

Name: NF5493_high_2
Description: NF5493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5493_high_2
NF5493_high_2
[»] chr5 (2 HSPs)
chr5 (202-411)||(10358573-10358782)
chr5 (1-115)||(10358372-10358486)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 202 - 411
Target Start/End: Original strand, 10358573 - 10358782
Alignment:
202 cctgaagattctgcagcttgatatactcccaaactttcttaacagcttcagtccgcgaaacttcaggcgcaccgatgaaattaccgagctcagaagtgac 301  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10358573 cctgaagattctgcagcttgatatactcccaaactttcttaacagcttcagtccgcgaaacttcaggcgcaccgatgaaattaccgagctcagaagtgac 10358672  T
302 ctgaactaccttctgtatccctccggtacccttgctcgtaaccgttttcttcaccgcggttttcttcacgacggttgtggatgcagctccggcggatgta 401  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10358673 ctgaactaccttctgtatccctccggtactcttgctcgtaaccgttttcttcaccgcggttttcttcacgacggttgtggatgcagctccggcggatgta 10358772  T
402 gccgccttct 411  Q
    ||||||||||    
10358773 gccgccttct 10358782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 10358372 - 10358486
Alignment:
1 acaacattcaaaaaatatccctaaaacacaccaatgcgattacaacaaacaataaccaaatcaaatagcgcaaaatcaatccataaaacctaatcaaagt 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10358372 acaagattcaaaaaatatccctaaaacacaccaatgcgattacaacaaacaataaccaaatcaaatagcgcaaaatcaatccataaaacctaatcaaagt 10358471  T
101 ttttcattcagtatc 115  Q
    |||| ||||||||||    
10358472 tttttattcagtatc 10358486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University