View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5493_high_2 (Length: 429)
Name: NF5493_high_2
Description: NF5493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5493_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 202 - 411
Target Start/End: Original strand, 10358573 - 10358782
Alignment:
| Q |
202 |
cctgaagattctgcagcttgatatactcccaaactttcttaacagcttcagtccgcgaaacttcaggcgcaccgatgaaattaccgagctcagaagtgac |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358573 |
cctgaagattctgcagcttgatatactcccaaactttcttaacagcttcagtccgcgaaacttcaggcgcaccgatgaaattaccgagctcagaagtgac |
10358672 |
T |
|
| Q |
302 |
ctgaactaccttctgtatccctccggtacccttgctcgtaaccgttttcttcaccgcggttttcttcacgacggttgtggatgcagctccggcggatgta |
401 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358673 |
ctgaactaccttctgtatccctccggtactcttgctcgtaaccgttttcttcaccgcggttttcttcacgacggttgtggatgcagctccggcggatgta |
10358772 |
T |
|
| Q |
402 |
gccgccttct |
411 |
Q |
| |
|
|||||||||| |
|
|
| T |
10358773 |
gccgccttct |
10358782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 10358372 - 10358486
Alignment:
| Q |
1 |
acaacattcaaaaaatatccctaaaacacaccaatgcgattacaacaaacaataaccaaatcaaatagcgcaaaatcaatccataaaacctaatcaaagt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358372 |
acaagattcaaaaaatatccctaaaacacaccaatgcgattacaacaaacaataaccaaatcaaatagcgcaaaatcaatccataaaacctaatcaaagt |
10358471 |
T |
|
| Q |
101 |
ttttcattcagtatc |
115 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
10358472 |
tttttattcagtatc |
10358486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University