View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5494_high_12 (Length: 265)
Name: NF5494_high_12
Description: NF5494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5494_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 32852361 - 32852609
Alignment:
| Q |
1 |
ctcgggtgattttgaatttgaagcatgcgtcaaacttgtgtcaataacatagaaacattaggctagtttgcattgtcgtcatttacgctcatgaattcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
32852361 |
ctcgggtgattttgaatttgaagcatgcgtcaaacttctgtcaataacatagaaacattaggctagtttgcaatgtcgtcatttaagctcatgaattcaa |
32852460 |
T |
 |
| Q |
101 |
ttccttaacaatgtgaacatgattaatgcagaacatgactaccatattttctggattatttgcagtattatcaaatcatgatgaaagcaagttttaggca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32852461 |
ttccttaacaatgtgaacatgattaatgcagaacatgactaccatattttctggattatttgcagtattatcaaatcatgatgaatgcaagttttaggca |
32852560 |
T |
 |
| Q |
201 |
acaatatgaatatattaaataacacaggccaaaataagcattgtattgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32852561 |
acaatatgaatatattaaataacacaagccaaaataagcattgtattgt |
32852609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University