View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5494_low_12 (Length: 284)
Name: NF5494_low_12
Description: NF5494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5494_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 266
Target Start/End: Complemental strand, 37817916 - 37817662
Alignment:
| Q |
11 |
cacagagggtagagctttgcttataaatcataatctatttcattcctattacatgatatcaacaaaaacatcagtaaaatatctcaaaacaacctttgtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37817916 |
cacagagggtagagctttgcttataa-tcataatctatttcattcctattacatgatatcaacaaaaacatcagtaaaataactcaaaacaacctttgtg |
37817818 |
T |
 |
| Q |
111 |
tcatgttaacaaattaagtctcctctctcattaccttcttccccataaaatacatgaattttaagtctgattcattaagagatcattctaccgattccaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37817817 |
tcatgttaacaaattaagtctcctctctcattaccttcttccccataaaatacatgaattttaagtctgattcattaagagatcattctaccgattccaa |
37817718 |
T |
 |
| Q |
211 |
agatctagcaccaacttaaattgaatcacgtacatctccactgaattctcataact |
266 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37817717 |
agatctagcaccaacataaattgaatcacgtacatctccgctgaattctcataact |
37817662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University