View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5494_low_3 (Length: 388)
Name: NF5494_low_3
Description: NF5494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5494_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 370
Target Start/End: Original strand, 32322634 - 32322984
Alignment:
| Q |
18 |
gttattatgagtcttaggtttaagttgttgtcttgataaattttaaatactttcgaatacaaacataaaatccacaaggtcttacttttacannnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32322634 |
gttattatgagtcttaggtttaagttgttgtcttgataaattttaaatactttcgaatacaaacataaaatccacaaggtcttacttttacatttttt-- |
32322731 |
T |
 |
| Q |
118 |
aaattcatgaatagt----atctgatttataacgagactaaaaaatgaattattattttatttacaaccaaacaaaattcactctcattcttctaactta |
213 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32322732 |
aaattcatgaataattagaatctgatttataacgagactaaaaaatgaattattattttatttacaaccaaacaaaattcactctcattcttcta----a |
32322827 |
T |
 |
| Q |
214 |
agattataatta-ccacgttgaccaccattctttcatgaatatcctagttgttacctaacgacataatatcgctcaaatttctatagatacaataattca |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || ||| |||||||||| ||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
32322828 |
agattataattacccacgttgaccaccattcttttatagatactctagttgttatataacgacataatatcgctcaaatctctatag-tacaataattca |
32322926 |
T |
 |
| Q |
313 |
atacttattttttatacttcatcggatagggcggagaaggattgttacctgatttgtc |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
32322927 |
atacttattttttatacttcatcggatagggcggagaagaattgttacttgatttgtc |
32322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University