View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5496-Insertion-1 (Length: 217)
Name: NF5496-Insertion-1
Description: NF5496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5496-Insertion-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 22297591 - 22297796
Alignment:
| Q |
8 |
tagattacatgtgagagtgtaagtctccgccttaaataaatttgtagagcatatggaaaccttgagaattgaggaccctttaccatatagcatgcatagc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22297591 |
tagattacatgtgagagtgtaagtctccgccttaaataaatttgtagagcatatggaaaccttgagaattgaggaccctttaccatatagcatgcatagc |
22297690 |
T |
|
| Q |
108 |
ctataaggtgattgaggagcaacatgatatatctggagggatgttaaatcatgttaatcaatcacttaaataaaacccttatatcataactgatagcttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22297691 |
ctataaggtgattgaggagcaacatgatatatctggagggatgttaaatcatgtgaatcaatcacttaaataaaaccctttcatcataactgatagcttt |
22297790 |
T |
|
| Q |
208 |
ttgcgt |
213 |
Q |
| |
|
|||||| |
|
|
| T |
22297791 |
ttgcgt |
22297796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21546068 - 21545985
Alignment:
| Q |
46 |
aatttgtagagcatatggaaaccttgagaattgaggaccctttaccatatagcatgcatagcctataaggtgattgaggagcaa |
129 |
Q |
| |
|
||||| ||||||||||||||||| ||| ||||| |||| ||| ||||||||| | |||| ||| || ||| |||||||||||| |
|
|
| T |
21546068 |
aatttttagagcatatggaaaccaagaggattgacgaccatttgccatatagcctacataacctttagggttattgaggagcaa |
21545985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University