View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5498-Insertion-5 (Length: 680)
Name: NF5498-Insertion-5
Description: NF5498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5498-Insertion-5 |
 |  |
|
| [»] scaffold0790 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0790 (Bit Score: 60; Significance: 3e-25; HSPs: 2)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 163 - 251
Target Start/End: Complemental strand, 2961 - 2871
Alignment:
| Q |
163 |
aattagtgtggcgctgttggtctctctgcacaatgaaacaacccttattcttcactgctttatttgttt--ctcttatcctcttcctcttc |
251 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| | ||||||||| |
|
|
| T |
2961 |
aattagtgtggcggtgtcggtctctctgcacaatgaaacaacccttattcttcactgctttattttttttcctcttatcattttcctcttc |
2871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 611 - 680
Target Start/End: Complemental strand, 2861 - 2797
Alignment:
| Q |
611 |
aaacctctcacaatcttgaagcctctttactttgcaaaactgatgataaatattccaaatccatggtaga |
680 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
2861 |
aaacctctcacaatcttgaagcctctttactttgtaaaactgat-----atattccaaatccatgataga |
2797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University