View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5498_low_4 (Length: 256)
Name: NF5498_low_4
Description: NF5498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5498_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 44432468 - 44432224
Alignment:
| Q |
1 |
cattttcggcggcgtgggatttcttggaagggcgttttgttgttgtcttcttcattttctaatctctttcgcgcgctcttaatttgtcttttcttact-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432468 |
cattttcggcggcgtgggatttcttggaagggcgttttgttgttgtcttcttcattttctaatctctttcgcgcgctcttaatttgtcttttcttactct |
44432369 |
T |
 |
| Q |
99 |
--taccaaatgtatgtatcaatgaacctgta-ccactatacaattgatttgaatatactatactacgccctaccccacatatctctattatacaattcat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432368 |
accaccaaatgtatgtatcaatgaacctgtacccactatacaattgatttgaatatactatactacgccctaccccacatatctctattatacaattcat |
44432269 |
T |
 |
| Q |
196 |
tcacaacacaacaggtttgttagttagttagggttctacattcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432268 |
tcacaacacaacaggtttgttagttagttagggttctacattcat |
44432224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University