View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5500-Insertion-7 (Length: 121)
Name: NF5500-Insertion-7
Description: NF5500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5500-Insertion-7 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 4e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 19240326 - 19240213
Alignment:
| Q |
8 |
atagattcatctggaactatatcagtcaactgcatcaaacgaaacaaataaagactttccttaaagcaactattttgcacataaccagaaatcattgcac |
107 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19240326 |
atagactcatccggtactatatcagtcaactgcatcaaacgaaacaaataaagactttccttaaagcaactattttgcacataaccagaaatcattgcac |
19240227 |
T |
|
| Q |
108 |
cccatatcccctta |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19240226 |
cccatatcccctta |
19240213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 19243357 - 19243251
Alignment:
| Q |
8 |
atagattcatctggaactatatcagtcaactgcatcaaacgaaacaaataaagactttccttaaagcaactattttgcacataaccagaaatcattgcac |
107 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19243357 |
atagactcatcaggtactatatcagtcaactgcatcaaacgaaacaaataaagactttccttaaagcaactattttgcacataaccagaaaccattgcac |
19243258 |
T |
|
| Q |
108 |
cccatat |
114 |
Q |
| |
|
||||||| |
|
|
| T |
19243257 |
cccatat |
19243251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University