View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5502-Insertion-10 (Length: 201)
Name: NF5502-Insertion-10
Description: NF5502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5502-Insertion-10 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 201
Target Start/End: Original strand, 44107904 - 44108097
Alignment:
| Q |
8 |
caaacatacacatagcttttgcaaaaccatggtggctcggtgcgatttccgcaaacacaatgtgatatcaaacatgcattgatataagacagaattaagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44107904 |
caaacatacacatagcttttgcaaaaccatggtggctcggtgcaatttccgcaaacacaatgtgatatcaaacatgcattgatataagacacaattaagg |
44108003 |
T |
|
| Q |
108 |
agcattggtgtcttttgtgtttttgagtttgcttgcattgttgttgattgtggttattaactcattagactggtttatatattatctattaaga |
201 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
44108004 |
agcatcggtgtcttttgtgtttttgagtttgcttgcattgttgttgattgtggttattaactcattaaactggtttatatgtcatctattaaga |
44108097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 44112243 - 44112295
Alignment:
| Q |
127 |
tttttgagtttgcttgcattgttgttgattgtggttattaactcattagactg |
179 |
Q |
| |
|
|||||| ||||| ||||||||||||||| || ||||||||| |||||| |||| |
|
|
| T |
44112243 |
tttttgggtttgtttgcattgttgttgaatgaggttattaattcattaaactg |
44112295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University