View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5502-Insertion-9 (Length: 189)
Name: NF5502-Insertion-9
Description: NF5502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5502-Insertion-9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 7 - 189
Target Start/End: Complemental strand, 49406333 - 49406151
Alignment:
| Q |
7 |
agatatatcacacatctttgcacatttggggaaaatggttaaagaggtttaagttcctgctcagcgctcacaaaggcgttatgtgatttgcaatgcagcg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49406333 |
agatatatcacacatctttgcacatttgggggaaatggttaaagaggtttaagttcctgctcagcgctcacaaaggcgttatgtgatttgcaatgcagcg |
49406234 |
T |
|
| Q |
107 |
gctcttatatactagcattctcataccgtgatcacggggtgtttttgcataattttcttgatggattatgggttccaatggct |
189 |
Q |
| |
|
||||| |||||| ||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
49406233 |
gctctcatatacaagcattctcataccgtggccacggggtgtttttgcataatgttcttgacggattatgggttccaatggct |
49406151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 85; Significance: 9e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 9e-41
Query Start/End: Original strand, 29 - 189
Target Start/End: Original strand, 52270156 - 52270311
Alignment:
| Q |
29 |
catttggggaaaatggttaaagaggtttaagttcctgctcagcgctcacaaaggcgttatgtgatttgcaatgcagcggctcttatatactagcattctc |
128 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| | ||||||||| |||||| |
|
|
| T |
52270156 |
catttggggaaaatggctaaagaggtttaagttcctgctcagtgctcacaaaggcgttatgtgatttgcaacatagcag-----atatactagaattctc |
52270250 |
T |
|
| Q |
129 |
ataccgtgatcacggggtgtttttgcataattttcttgatggattatgggttccaatggct |
189 |
Q |
| |
|
||||| || |||| |||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
52270251 |
ataccatggccacgtggtgtttttgcataatgttcaggatggattatgggttccaatggct |
52270311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University