View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5504-Insertion-2 (Length: 137)
Name: NF5504-Insertion-2
Description: NF5504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5504-Insertion-2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 7 - 137
Target Start/End: Original strand, 56227478 - 56227608
Alignment:
| Q |
7 |
actcaaagcagaatgtcttccaaaaaccattccattttcctcttatccctgttcattctttctacagcattttttcaatcatctgcagtgaaaagggtaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
56227478 |
actcaaagcagaatgtcttccaaaaaccattccattttcctcttatccctgttcattctttctacagctttttttcaatcatcagcagtgaaaaaggtaa |
56227577 |
T |
 |
| Q |
107 |
aactcttgtcactatattctttcttttttgc |
137 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
56227578 |
aactcttgtcactattttctttcttttttgc |
56227608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University