View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5505-Insertion-10 (Length: 193)
Name: NF5505-Insertion-10
Description: NF5505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5505-Insertion-10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 193
Target Start/End: Original strand, 25542006 - 25542191
Alignment:
| Q |
8 |
caccccacctacccaaaacttgtttacttgcattagttgatacctttatatagagtatcttatactaattagtttattctctattcattgttttagacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
25542006 |
caccccacctacccaaaacttgtttacttgcattagttgataccttcatatagagtatcttatactaattagtttatattctactcattgttttagacat |
25542105 |
T |
|
| Q |
108 |
gacaaagctattttttgattcaggtgtcttaggtctcagtcttgccccttttgccgggatagtttgaagagagtgaactctggtga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25542106 |
gacaaagctattttttgattcaggtgtcttaggtctcaatcttgccccttttgccgggatagcttgaagagagtgaactctggtga |
25542191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University