View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5505_low_3 (Length: 224)
Name: NF5505_low_3
Description: NF5505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5505_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 28614515 - 28614319
Alignment:
| Q |
13 |
agcacagatatagcagtggtttgtgcaatgaactgtcttctggttctggaaggttcgagagaagctttaacgacgaagcttcgaggtctcggagaatgaa |
112 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28614515 |
agcactgatatagcagtggtttctgcaatgaactgtcttctggttctggaaggttcgagagaagctttaacaacgaagcttcgaggtctcggagaatgaa |
28614416 |
T |
|
| Q |
113 |
tga---tggatttagaagaaggtagttgagataacggtctgcatagtgtggtagttgagtctgagaatgtgaattgcagcgtcgccattgggaaagg |
206 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28614415 |
tgatggtggatttagaagaaggtaattgagataacggtctgcatagtgtggtagttgagtctgagaatgtgaattgcagcgtcgccattgggaaagg |
28614319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University