View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5507-Insertion-6 (Length: 291)
Name: NF5507-Insertion-6
Description: NF5507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5507-Insertion-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 8 - 287
Target Start/End: Original strand, 14696238 - 14696517
Alignment:
| Q |
8 |
gtatcatccaacatgtcgtaacaaatcaccctcaccatgtcattgcttgaaattgaagtaatgtatgactctataaacttcatgacacctaagtgtctcc |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14696238 |
gtatcatccaacatgtggtaacaaatcaccctcaccatgtcattgcttgaaattgaagtaatgtatgactctataaacttcatgacacctaagtgtctcc |
14696337 |
T |
 |
| Q |
108 |
taatttgagatggaatttgttcttgaccgagcagtagattaaggctcatttacataggcccaaaccaaaacaaggccaattccgcatttcgttcaattac |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14696338 |
taatttgagatggaatttgttctggaccgagcagtagattaaggctcatttacataggcccaaaccaaaacaaggccaattccgcatttcgttcaattac |
14696437 |
T |
 |
| Q |
208 |
tcctaacacatctctccccataggagggtgttcatagcacttcgggacccattcaaaccgaatggagaacgtctcccaaa |
287 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
14696438 |
tcctaacacatctctccccgcaggagggtgttaatagcacttcgggccccattcaaatcgaatggagaacgtctcccaaa |
14696517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University