View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5507-Insertion-9 (Length: 220)
Name: NF5507-Insertion-9
Description: NF5507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5507-Insertion-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 74 - 220
Target Start/End: Complemental strand, 7989036 - 7988890
Alignment:
| Q |
74 |
tatgagcaaatttcgttcgcttgtctactaatggaggttccttacccattccatagctttcaagaggctgatagcctccccaatatctacatcagtgata |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7989036 |
tatgagcaaatttcgttcgcttgtctactaatggaggtcccttacccattccatagctttcaagaggctgatagcctccccaatatctacatcaatgata |
7988937 |
T |
|
| Q |
174 |
ggtgagaaccattctgtttgagccagcacaaaggctccttatgcgtc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7988936 |
ggtgagaaccattctgtttgagccagcacaaaggctccttatgcgtc |
7988890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 106
Target Start/End: Original strand, 24354557 - 24354645
Alignment:
| Q |
17 |
ttggaatgtgagaataaacgcggaaactagcttctgacaaagccgcctgagctaaactatgagcaaatttcgttcgcttgtctactaatg |
106 |
Q |
| |
|
||||||| | ||| ||||||||||||||||||| ||| ||| | |||| |||||| |||||||| || |||||| |||||||| |||||| |
|
|
| T |
24354557 |
ttggaatataagagtaaacgcggaaactagcttatgaaaaaactgccttagctaagctatgagc-aacttcgtttgcttgtcttctaatg |
24354645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University