View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5508-Insertion-5 (Length: 86)
Name: NF5508-Insertion-5
Description: NF5508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5508-Insertion-5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 9e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 9e-33
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 131132 - 131058
Alignment:
| Q |
8 |
actcttatcctccatcttcagcctatccaccgccttcataccctccacctccaggttatcctccaaacgctggta |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
131132 |
actcttatcctccatcttcagcctatccaccgccttcataccctccacctacaggttatcctccaaacgctggta |
131058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 7e-21
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 161916 - 161990
Alignment:
| Q |
8 |
actcttatcctccatcttcagcctatccaccgccttcataccctccacctccaggttatcctccaaacgctggta |
82 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| || ||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
161916 |
actcttatccgccatcttcagcttatccaccaccatcataccctccacctgcaggttatcctccaaacactggta |
161990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University