View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5508_low_2 (Length: 330)
Name: NF5508_low_2
Description: NF5508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5508_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 16 - 317
Target Start/End: Original strand, 17438978 - 17439279
Alignment:
| Q |
16 |
caatatttatgctgctcaactgtttggcattaccttgtggagaatatggaggggaagaaacaattgtgtgctcaataaacaaaagttctgtccacccctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17438978 |
caatatttatgctgctcaactgtttggcattactttgtggagaatatggaggggaagaaacaattgtgtgttcaataaacaaaagttctgtccaccccta |
17439077 |
T |
 |
| Q |
116 |
atagcagcagaaattgttggatttgctaatgaatttgctcatagtaccatttctgaaacggtccagggaacacatttggcccctccttgttggtgtgcgc |
215 |
Q |
| |
|
|||||||||||||||| ||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17439078 |
atagcagcagaaattgctggatttactgatgaatttactcatagtaccatttctgaaacggtccagggaacacatttggcccctccttgttggtgtgcgc |
17439177 |
T |
 |
| Q |
216 |
caggtatgggttcaactaagataaatattgatgctggatgttttgataatggtgtgacagcttggggtttcttagaaagggatcataaaggtgatgttat |
315 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17439178 |
cagatatgggttcaactaagataaatatcgatgctggatgttttgataatggtgtgacagcttggggactcttagaaagggatcataaaggtgatgttat |
17439277 |
T |
 |
| Q |
316 |
ct |
317 |
Q |
| |
|
|| |
|
|
| T |
17439278 |
ct |
17439279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 239 - 324
Target Start/End: Complemental strand, 15056005 - 15055920
Alignment:
| Q |
239 |
aatattgatgctggatgttttgataatggtgtgacagcttggggtttcttagaaagggatcataaaggtgatgttatctgtgctgc |
324 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || |||||||| | |||||| ||||||||| |||||||||| || |||||| |
|
|
| T |
15056005 |
aatattgatgctggatgttttgaaaatggtgtcacggcttggggactaatagaaaaggatcataagggtgatgttaactttgctgc |
15055920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University