View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5510_low_3 (Length: 287)

Name: NF5510_low_3
Description: NF5510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5510_low_3
NF5510_low_3
[»] chr6 (1 HSPs)
chr6 (1-266)||(19751728-19751990)


Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 19751728 - 19751990
Alignment:
1 tactcccaaaacctgctcgaaccaaaatagaaattgtcttagaacaagtacaaatatagatttacatcaagcgattacatcccttaaatagagaacaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19751728 tactcccaaaacctgctcgaaccaaaatagaaattgtcttagaacaagtacaaatatagatttacatcaagcgattacatcccttaaatagagaacaaat 19751827  T
101 gtgttacaaaaagctactaaaaaattaacagtaatgttatacatagcgagaaacattatcccaaacggatcacgaaccgaaaatagaccaacgaaaaatc 200  Q
    |||| ||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
19751828 gtgtaacaa---gctactaaaaaattaacagtaatgttatacatagcgagaaacattatcccaaacggatcacaaaccgaaaatagaccaacgaaaaatc 19751924  T
201 agtgatgggcgacaataacggaaggtttggaacataaattgaagtcaacaaataaagggtgagtgg 266  Q
    ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
19751925 agtgatgggtgacaataaaggaaggtttggaacataaattgaagtcaacaaataaagggtgagtgg 19751990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University