View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5512-Insertion-3 (Length: 425)
Name: NF5512-Insertion-3
Description: NF5512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5512-Insertion-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 165 - 248
Target Start/End: Original strand, 48412734 - 48412817
Alignment:
| Q |
165 |
gtttttgctttacagatttatttattgctcacaccaaaggaaggtggtttgcgcgggaactcatgacccacaatggcggcaaat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412734 |
gtttttgctttacagatttatttattgctcacaacaaaggaaggtggtttgcgcgggaactcatgacccacaatggcggcaaat |
48412817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 48412581 - 48412649
Alignment:
| Q |
8 |
atttcattgttgcggcgaatgttttcgagtcgtttgcgttcgtactcagtgagtttctgaggcgccatt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412581 |
atttcattgttgcggcgaatgttttcgagtcgtttgcgttcgtactcagtgagtttctgaggcgccatt |
48412649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 105 - 145
Target Start/End: Original strand, 48412678 - 48412718
Alignment:
| Q |
105 |
gaaattagggatttgggttttccgaattggattggaatagt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412678 |
gaaattagggatttgggttttccgaattggattggaatagt |
48412718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University