View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5512_low_6 (Length: 232)
Name: NF5512_low_6
Description: NF5512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5512_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 2 - 186
Target Start/End: Original strand, 866989 - 867173
Alignment:
| Q |
2 |
gatgatgtggttgaagatgatgaagggaattcattgttggagttgaaacgagaaaatgtgtctctaggattagggttagggttagggtttgaggagatgg |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
866989 |
gatgatgaggttgaagatgatgaagggaattcattgttggagttgaaacgagaaaatgtgtctctagggttagggttagggttagggtttgaggagatgg |
867088 |
T |
 |
| Q |
102 |
aaatgtaagggcggagggaacggggttgaagcatttttgcgtttcagtggtttgtttgactcacacagctctgacgagtgatgag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
867089 |
aaatgtaagggcggagggaacggggttgaagcatttttgcgtttcagtggtttgtttgactcacacagctctgacgagtgatgag |
867173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 2 - 186
Target Start/End: Original strand, 1228266 - 1228450
Alignment:
| Q |
2 |
gatgatgtggttgaagatgatgaagggaattcattgttggagttgaaacgagaaaatgtgtctctaggattagggttagggttagggtttgaggagatgg |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1228266 |
gatgatgaggttgaagatgatgaagggaattcattgttggagttgaaacgagaaaatgtgtctctagggttagggttagggttagggtttgaggagatgg |
1228365 |
T |
 |
| Q |
102 |
aaatgtaagggcggagggaacggggttgaagcatttttgcgtttcagtggtttgtttgactcacacagctctgacgagtgatgag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1228366 |
aaatgtaagggcggagggaacggggttgaagcatttttgcgtttcagtggtttgtttgactcacacagctctgacgagtgatgag |
1228450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University