View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5513_high_4 (Length: 233)
Name: NF5513_high_4
Description: NF5513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5513_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 42226207 - 42225999
Alignment:
| Q |
17 |
aaaagcttggtgagtagggtctcagcatctgatcactaagagagtgacaatttaaatgaggtagcagaatttgcactatttaagaagcactatattcaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42226207 |
aaaagcttggtgagtagggtctcagcatctgatcactaagagagtgacaatttaaatgaggtagtagaatttgcactatttaagaagcactatattcaca |
42226108 |
T |
 |
| Q |
117 |
gatgtatgaaccaaccagcattagcaatacaatacatgtcatgcatatgatcaacctattcatttcgtatagctagctctagcttcattttaattttata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42226107 |
gatgtatgaaccaaccagcattagcaatacaatacatgtcatgcatatgatcaacctattcatttcgtatagctagctctagcttcattttaa-tttata |
42226009 |
T |
 |
| Q |
217 |
tatattcttc |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
42226008 |
tatattcttc |
42225999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University