View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5513_low_2 (Length: 248)
Name: NF5513_low_2
Description: NF5513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5513_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 1610256 - 1610499
Alignment:
| Q |
1 |
atcaagaatcctggttcaagagctgatacaactaatgaaacttgttgcttagttttgagagtctcgatcagcttctgcacaacacgagtgttgtgggaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1610256 |
atcaagaatcctggttcaagagctgatacgactaatgaaacttgttgcttagttttgagagtctcgatcagcttctgcacaacacgagtgctgtgggaag |
1610355 |
T |
 |
| Q |
101 |
gagagaacaatgaggtcaagttcagcattagataataagtacattatttcatattaattataaaatagttgcatgactacccgtgagtatttaacgagat |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610356 |
gagagaacaatgaggtcaagttcaacattagataataagtacattatttcatattagttataaaatagttgcatgactacccgtgagtatttaacgagat |
1610455 |
T |
 |
| Q |
201 |
tctgacaagctgccccggctcctggataaccatcagtataatct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1610456 |
tctgacaagctgccccggctcctggataaccatcagtatgatct |
1610499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University