View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5513_low_3 (Length: 246)
Name: NF5513_low_3
Description: NF5513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5513_low_3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 1609839 - 1610067
Alignment:
| Q |
18 |
atttattatggagtttttgcaatagttatggtgggacattatatactgaatttagtgtaattttcttctcatatagttgtggttagtagacagaactttc |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1609839 |
atttgttatggagtttttgcaatagttatggtgggacattatatattgaatttagtgtaattttcttctcatatagttgtggttagtagacagaactttc |
1609938 |
T |
|
| Q |
118 |
agacaatacgtaactgcaggtggagggcgattggatggtaatttggagacttgcagtgcagccaaaggtgagaaattttgtctggaaagtgaaagtggcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1609939 |
agacaatacgtaactgcaggtggagggtgattggatggtaatttggagacttgcagtgcagccaaaggtgagaaattttgtctggaaagtgaaagtggcc |
1610038 |
T |
|
| Q |
218 |
gaaaattgtctactaacacgtgtaaaact |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1610039 |
gaaaattgtctactaacacgtgtaaaact |
1610067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University