View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5514-Insertion-16 (Length: 262)
Name: NF5514-Insertion-16
Description: NF5514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5514-Insertion-16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 10048716 - 10048842
Alignment:
| Q |
8 |
aaatgcggtcgaaattgcaattacgatgccgttattgacacctctaaatcttttatattgtggctgcaattgcggttagggaccgctatttaaaaccata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10048716 |
aaatgcggtcgaaattgcaattacgatgccgttgttgagacctctaaatcttttatattatggctgcaattgcggctagggaccgctgtttaaaaccata |
10048815 |
T |
|
| Q |
108 |
gtgcaatcataaatttcatataaaaaa |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10048816 |
gtgcaatcataaatttcatataaaaaa |
10048842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 152 - 261
Target Start/End: Original strand, 10049123 - 10049233
Alignment:
| Q |
152 |
tccaaattctagttgtggtcgcatttacaatcacgctgcaaatactaatattgattctaactctatttattttaa-nnnnnnnngaaagaactctattta |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10049123 |
tccaaattctagttgtggtcgcagttacaatcacgctgcaaatactaatattgattctaactctatttattttaatatttttttgaaagaactctattta |
10049222 |
T |
|
| Q |
251 |
ttttaatgtag |
261 |
Q |
| |
|
||||||||||| |
|
|
| T |
10049223 |
ttttaatgtag |
10049233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 47 - 80
Target Start/End: Complemental strand, 26777171 - 26777138
Alignment:
| Q |
47 |
acctctaaatcttttatattgtggctgcaattgc |
80 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
26777171 |
acctctaaaacttttatattgtggctgcaattgc |
26777138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University