View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5514-Insertion-18 (Length: 188)
Name: NF5514-Insertion-18
Description: NF5514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5514-Insertion-18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 188
Target Start/End: Complemental strand, 2802573 - 2802393
Alignment:
| Q |
8 |
ttgacaaccctttatccagcttcaaagaacagcaaaactgtactatatcagaactctttgcctcagaaactgatcatatgccctcaccaaacagcttgaa |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2802573 |
ttgacaaccctttagccagcttcaaagaacagcaaaactgtactataacagaactctttgcctcagaaactgatcatatgccctcaccaaactgcttgaa |
2802474 |
T |
 |
| Q |
108 |
ctcaatacattgtgaagccatttctctcatacttcaggtaaaaattaggcctacataataaattttttcaattcctcttct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2802473 |
ctcaatacattgtgaagccatttctctcatacttcaggtaaaaattaggcctacataatacattttttcaattcctcttct |
2802393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University