View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5514-Insertion-6 (Length: 162)
Name: NF5514-Insertion-6
Description: NF5514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5514-Insertion-6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 8 - 162
Target Start/End: Complemental strand, 47053773 - 47053619
Alignment:
| Q |
8 |
ctaagctctattagggtttagtttcttcttagagaagagtgtgtgctcttccagcttggctcgtgtgtctctttgcctttgctccctttctctctttgtt |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053773 |
ctaagctctgttagggtttagtttcttcttagagaagagtgtgtgctcttccagcttggctcgtgtgtctctttgcctttgctccctttctctctttgtt |
47053674 |
T |
 |
| Q |
108 |
tcagttgtgattttgttgcgctaagattcgtctctatgcccagttgtgttgtgtc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053673 |
tcagttgtgattttgttgcgctaagattcgtctctatgcccagttgtgttgtgtc |
47053619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University