View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5514-Insertion-9 (Length: 200)
Name: NF5514-Insertion-9
Description: NF5514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5514-Insertion-9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 28 - 138
Target Start/End: Original strand, 36152330 - 36152440
Alignment:
| Q |
28 |
aatgttagtatattgtggacttaattacctgaaccacatgtgaaggaacttccatactctcaaatttatttagtggtatagctttgggtctatatttcct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36152330 |
aatgttagtatattgtggacttaattacctgaaccacatgtgaaggaacttccatactctcaaatttatttagtggtatagctttgggtctatatttcct |
36152429 |
T |
 |
| Q |
128 |
tttccacgttg |
138 |
Q |
| |
|
||||||||||| |
|
|
| T |
36152430 |
tttccacgttg |
36152440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University