View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5514_low_7 (Length: 227)

Name: NF5514_low_7
Description: NF5514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5514_low_7
NF5514_low_7
[»] chr4 (1 HSPs)
chr4 (17-211)||(45479915-45480109)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 45479915 - 45480109
Alignment:
17 taggacaaatgttgaatgtatgcacgacaaacgcattggctagggtaatgataggacggcgagtatttaatgaggggaatggtgggtatgaatgtgatcc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
45479915 taggacaaatgttgaatgtatgcacgacaaacgcattggctagggtaatgataggacggcgagtatttaatgaggggaatggtgggtgtgaatgtgatcc 45480014  T
117 tagggctgatgagtttaagtctatggtggttgaacttatggtattggctggtgttttcaatattggtgattttcttcctgctttcgagtggttgg 211  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45480015 tagggctgatgagtttaagtctatggttgttgaacttatggtattggctggtgttttcaatattggtgattttcttcctgctttcgagtggttgg 45480109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University