View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5516-Insertion-5 (Length: 290)
Name: NF5516-Insertion-5
Description: NF5516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5516-Insertion-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 9 - 290
Target Start/End: Original strand, 40029911 - 40030192
Alignment:
| Q |
9 |
aatcttcaagagccatgcgacggggggacttgcggcggcattcatctggaagaccattagcataacgtctaacatcatgacaataatcataaacaagcca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40029911 |
aatcttcaagagccatgcgacggggggacttgcggcggcattcatttggaagaccattagcataacgtctaacatcatgacaataatcataaacaagcca |
40030010 |
T |
|
| Q |
109 |
ttttgaataaatctgattaagcttcttccttgagtcaatactaagacctctatttgttccaccattgaaaccaacacaattattagattgacttggaacg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030011 |
ttttgaataaatctgattaagcttcttccttgagtcaatactaagacctctatttgttccaccattgaaaccaacacaattattagattgacttggaacg |
40030110 |
T |
|
| Q |
209 |
caagcattggcattgaagttgctaaaccaagctgtgaatggaccctttgaccaatcaaccttcattgttcctccttgtgttg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030111 |
caagcattggcattgaagttgctaaaccaagctgtgaatggaccctttgaccaatcaaccttcattgttcctccttgtgttg |
40030192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 16288037 - 16287969
Alignment:
| Q |
43 |
gcggcattcatctggaagaccattagcataacgtctaacatcatgacaataatcataaacaagccattt |
111 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||| | |||| ||||||||||||||| | |||||| |
|
|
| T |
16288037 |
gcggcattcatatggaagaccatgagcataacgtcttaaatcagcacaataatcataaactacccattt |
16287969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University