View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5517-Insertion-11 (Length: 460)
Name: NF5517-Insertion-11
Description: NF5517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5517-Insertion-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 11 - 383
Target Start/End: Complemental strand, 31406635 - 31406263
Alignment:
| Q |
11 |
aaggtagctcatttggacttgagagcactgggacttccaaatgttgtggatcccgcaagaaatattcaccctgagcttgtcctagctgctgctgattctg |
110 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31406635 |
aaggcagctcatttggccttgagagcactgggacttccaaatgctgtggatcatgcaggaaatattcaccctgagcttgtcctagctgctgctgattctg |
31406536 |
T |
|
| Q |
111 |
ctgatattgcagaagcaaaattattgttaccatattaactatttagttaatagaatcgaagtgctactagccagaaataaaactttgtctttgttgtttg |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
31406535 |
ctgatattgcagaagcttaattattgttaccatattaactatttagttaatagtatcgaagtgctagtaaccagaaataaaactttgtctttgttgtttg |
31406436 |
T |
|
| Q |
211 |
gaastcactattatgggccggttgatgtgactctctatgatcttttttgtcattaatatgaatgaatgtgtttgccaactccgtgcctttctttctcctc |
310 |
Q |
| |
|
| | ||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
31406435 |
ttagtagtgattatgggcaggttgatgtgactctgtatgagcttttttgtcattaatatgaatgaatgtgtttgccaactccttgcatttctttctcctc |
31406336 |
T |
|
| Q |
311 |
cacgaatatttatgagtgttttataatgaacagggaatactattaaggggacagaattccccctatcctccca |
383 |
Q |
| |
|
||| ||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31406335 |
cactaatatttatgattgttttttaatgaaaagggaatactattaaggggacagaattcccccaatcctccca |
31406263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 392 - 460
Target Start/End: Complemental strand, 31405880 - 31405812
Alignment:
| Q |
392 |
tttctgcatcttagatagggtttcctactattttcctctatactaacacttgatcgaggccttcacatt |
460 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31405880 |
tttctgcatcttagatagggtttcctactattttcctctatactagcacttgatcaaggccttcacatt |
31405812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University