View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5517-Insertion-13 (Length: 162)
Name: NF5517-Insertion-13
Description: NF5517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5517-Insertion-13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 5e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 6 - 162
Target Start/End: Original strand, 21273103 - 21273259
Alignment:
| Q |
6 |
caatgttgatttgtaaatatcttagttatacaatatttttagagtggacagaaatggataacttggacgcagttacttggtctcctcatatggtagttat |
105 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21273103 |
caatgttgatttgtaaataccttcgttatacaatatttttagagtggacagaaatggataacttggacgcagttacttggtctcctcatatggtagttat |
21273202 |
T |
|
| Q |
106 |
tgacttggaattcaacgggaacttgactgcttgtgtgaattccttctcttcctctat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21273203 |
tgacttggaattcaacgggaacttgactgcttgtgtgaattccttctcttcctctat |
21273259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University