View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5517-Insertion-4 (Length: 706)
Name: NF5517-Insertion-4
Description: NF5517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5517-Insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 396 - 447
Target Start/End: Complemental strand, 51564007 - 51563956
Alignment:
| Q |
396 |
aatgacctgaagagctaaatttattaatgtttaatttttaaggagtattgca |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
51564007 |
aatgacctgaagagctaaatttattaatgtttaatttttaatgaatattgca |
51563956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 627 - 706
Target Start/End: Complemental strand, 51563730 - 51563651
Alignment:
| Q |
627 |
ggcatgcaactccatactctttcacagctattttcacatcaacaattgattttagtatatattataggatcgttctaaca |
706 |
Q |
| |
|
||||| |||||||||||||||| ||| |||||||| | ||||||||||||||| || ||||| || || |||||||||| |
|
|
| T |
51563730 |
ggcattcaactccatactctttgacaaatattttcataacaacaattgattttaataaatattttaagagcgttctaaca |
51563651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University