View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5517_high_3 (Length: 488)
Name: NF5517_high_3
Description: NF5517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5517_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 29 - 280
Target Start/End: Original strand, 22191029 - 22191280
Alignment:
| Q |
29 |
ttgttattgattcaccttcactgaggaacgtactctcaaagaaaataaattatataaactatgaataggtttataactacggcattttcaatttctgctt |
128 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22191029 |
ttgttattgattcaccttcactgaggaccttactctcaaagaaaataaattatataaactatcaataggtttataactacggcattttcaatttctgctt |
22191128 |
T |
|
| Q |
129 |
tggcacttcttttctaggcatgtgaaacttctaaataagtgactggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22191129 |
tggcacttcttttctaggcatgtgaaacttctaaataagtgactggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaat |
22191228 |
T |
|
| Q |
229 |
atgttttgttatgagagtttgtatctcttttatggattgtaagacattattt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
22191229 |
atgttttgttatgagagtttgtatctctttgatggattgtaagactttattt |
22191280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 285 - 329
Target Start/End: Original strand, 6983341 - 6983385
Alignment:
| Q |
285 |
atttattttcaaatgcatctctgatattaccaatttaatgtcatc |
329 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
6983341 |
atttattttcaaattcatctcctatattaccaacttaatgtcatc |
6983385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University