View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5520-Insertion-10 (Length: 155)
Name: NF5520-Insertion-10
Description: NF5520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5520-Insertion-10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 4e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 4e-58
Query Start/End: Original strand, 10 - 155
Target Start/End: Original strand, 40544616 - 40544760
Alignment:
| Q |
10 |
tatttctcattagctattcttgctttgcatggagaaaccagttctacttattcaaaaaagagggaggtcaaccgatggctatctattgggatttctaata |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
40544616 |
tatttctgattagctattcttgctttgcatggagaaaccagttctacttattcaaaaaa-agaggggtgagccgatggctatctattgggatttctaata |
40544714 |
T |
 |
| Q |
110 |
atgggaatgttgtttctcatcttttcattattgatctttatcttgt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40544715 |
atgggaatgttgtttctcatcttttcattattgatcattatcttgt |
40544760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University