View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5520_low_5 (Length: 327)
Name: NF5520_low_5
Description: NF5520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5520_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 162998 - 163304
Alignment:
| Q |
1 |
ctgtaaagaactgttactctatattctataca--gtgtttcgacctcaagccacatttctgcggtattgtttgcttttgagtcttgtgtgtaagacttca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
162998 |
ctgtaaagaactgttactctatattctatacacagtgtttcgacctcaagccacatttctgcggtattgtttgcttttgagtcttgtgtgtaagacttca |
163097 |
T |
 |
| Q |
99 |
cggaactcatagtaagctattgtatgttactcatcagtcaagactttaggagcatgagccgttgatatttgcaaatcagtaagaagattggtgagctaca |
198 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
163098 |
cggaacttatagtaagctattgtatgttactcatcagtcaagactttaggagcatgagccgttgatatttgcaaataagtaagaagattggtgagctacg |
163197 |
T |
 |
| Q |
199 |
tgagctcaaatgtcattgttggaactttcgtgtaatcagctttctgttgaagatcttgcaacaannnnnnnnatttctttgatagccatgagactagatt |
298 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
163198 |
tgagctcaaatgtca---ttggaactttcgtgtaatcagctttctgttgaagatcttgcaacaattttttttatttctttgatagccatgagattagatt |
163294 |
T |
 |
| Q |
299 |
gccaccaaag |
308 |
Q |
| |
|
|||||||||| |
|
|
| T |
163295 |
gccaccaaag |
163304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University