View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5522-Insertion-11 (Length: 322)
Name: NF5522-Insertion-11
Description: NF5522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5522-Insertion-11 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 40 - 322
Target Start/End: Original strand, 25117846 - 25118127
Alignment:
| Q |
40 |
agaagtacataatatcctaaagatgagaacgggaaattgttctttgcaacaaggcctaaccacagaagcagcaaacataataaagcaagcaataacccta |
139 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25117846 |
agaagtacataat-tcctaaagatgagaacgggaaactgttctttgcaacaaggcctaacaacagaagctgcaaacataataaagcaagcaataacccta |
25117944 |
T |
 |
| Q |
140 |
gcaaagcgtcgtggccatgctcaagtaacaccacttcatgttgcaaacactatgcttagtgttaccaatggattattaagaacagcttgtcttcaatctc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25117945 |
gcaaagcgtcgtggccatgctcaagtaacaccacttcatgttgcaaatacgatgcttagtgttaccaatggattattaagaacagcttgtcttcaatctc |
25118044 |
T |
 |
| Q |
240 |
actctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgcactcaatcgtttgccagcgacgacttgtaatagc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118045 |
actctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgcactcaatcgtttgccagcgacgacttgtaatagc |
25118127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 215 - 300
Target Start/End: Complemental strand, 40588860 - 40588775
Alignment:
| Q |
215 |
ttaagaacagcttgtcttcaatctcactctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgcactcaatcgttt |
300 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||| ||| | |||||||| |||||||| |||||||| ||||| |
|
|
| T |
40588860 |
ttaagaaaagcttgtcttcaatgtcactctcaccctcttcaatgcaaagctcttgagctttgtttcaatgttgcactcaaccgttt |
40588775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University