View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5522_low_11 (Length: 219)
Name: NF5522_low_11
Description: NF5522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5522_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 45520457 - 45520644
Alignment:
| Q |
19 |
gattgaaaattgtgatgatggtgagttgtggtaggtaaagaagaaggttcggttcggtccggtccggtgggg-ctagctaggtgcaacttgattgattga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45520457 |
gattgaaaattgtgatgatggtgagttgtggtaggtaaagaagaaggt----------ccggtccggtgggggctagctaggtgcaacttgattgattga |
45520546 |
T |
|
| Q |
118 |
gtgagttagtggaagatgatgcaagttccttggtcatatgaaattggggtaggtaagtgaaaagaaaagcatcatggttcgggtgggtttagaaggaacc |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
45520547 |
gtgagttagtggaagatg---caagttccttggtcatatgaaattggggtaggtaagtgaaaagaaaagcatcatggatcgggtgggtttagagggaacc |
45520643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University