View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5522_low_3 (Length: 373)
Name: NF5522_low_3
Description: NF5522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5522_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 8e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 167 - 291
Target Start/End: Original strand, 44799682 - 44799806
Alignment:
| Q |
167 |
ggttgcttgcggcacaagaatctggttcagcttaaaggacagtgttgtgaagggaatgaactggttttggtttatgagtatttaccatatggaagccttc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
44799682 |
ggttgcttgcggcacaagaatctggttcagcttaaagggtggtgttgtgaagggaatgaattggttttggtttatgagtatctaccaaatggaagccttg |
44799781 |
T |
 |
| Q |
267 |
ataaagttcttcatagaaatttaag |
291 |
Q |
| |
|
|||||||||| ||||| |||||||| |
|
|
| T |
44799782 |
ataaagttctgcataggaatttaag |
44799806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 3e-24; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 8350062 - 8349969
Alignment:
| Q |
1 |
gtttcttatttccctgttaactattatccctcgcgcttgtagtcatgtagtattaatttacatctgctactt-atcaagaagagtgtaatcaac |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| | | |||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
8350062 |
gtttcttatttccctgttaactattatccctcacgcttgtagtcatgcaatgttaatttacatctgctacttaattatcaagagtgtaatcaac |
8349969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 8349669 - 8349624
Alignment:
| Q |
157 |
ttcaatgattggttgcttgcggcacaagaatctggttcagcttaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8349669 |
ttcaatgattggttgcttgcggcacaagaatctggttcagcttaaa |
8349624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8260630 - 8260574
Alignment:
| Q |
1 |
gtttcttatttccctgttaactattatccctcgcgcttgtagtcatgtagtattaat |
57 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| || ||||||||||| ||||||||| |
|
|
| T |
8260630 |
gtttcttatttccctgttaactcttatctctcacgtttgtagtcatgcagtattaat |
8260574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 8352788 - 8352758
Alignment:
| Q |
1 |
gtttcttatttccctgttaactattatccct |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8352788 |
gtttcttatttccctgttaactattatccct |
8352758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University