View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523-Insertion-17 (Length: 96)
Name: NF5523-Insertion-17
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523-Insertion-17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 7e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 7e-43
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 52768805 - 52768892
Alignment:
| Q |
8 |
gctacaagtcctccccttatttctgatggtgacaattctgcaatatacacgggagcagtaactgaagctatacccacgcccaaaccaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52768805 |
gctacaagtcctccccttatttctgatggtgacaattctgcaatatacacgggagcagtaactgaagctatacccacgcccaaaccaa |
52768892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 38013778 - 38013842
Alignment:
| Q |
20 |
ccccttatttctgatggtgacaattctgcaatatacacgggagcagtaactgaagctatacccac |
84 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || ||||| || || || |||| |||||| |
|
|
| T |
38013778 |
ccccttatttctgatggtgaggattctgcaatatatacaggagccgtgacagaggctacacccac |
38013842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University