View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523-Insertion-7 (Length: 424)
Name: NF5523-Insertion-7
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523-Insertion-7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 8 - 424
Target Start/End: Complemental strand, 40506172 - 40505756
Alignment:
| Q |
8 |
ccacctgcttcacgattccggcgacgaatggcggcttacttcgccaccgcacttcactgaccaccagaagagggtgtttgtcagtttccggcggaacctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40506172 |
ccacctgcttcacgattccggcgacgaatggcggcttacttcgccaccgcacttcactgaccaccagaagagggtgtttgtcagtttccggcggaacctc |
40506073 |
T |
|
| Q |
108 |
cttcttccacacctctccttcatcaaagcgctctttgtcattcacatgcttgagcatttcttctgattcccgtaagtacccaccatttcttcttcattgc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40506072 |
cttcttccacacctctccttcatcaaagcgctctttgtcattcacatgcttgagcatttcttctgattcccgtaagtacccaccatttcttcttcattgc |
40505973 |
T |
|
| Q |
208 |
attttccaccaaaatcaataaagttacattttttacaatacgggtaattgtttttcctaatgttaacgttaattctgatcatggattgaggaatgtataa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40505972 |
attttccaccaaaatcaataaagttacattttttacaatacgggtaattgtttttcctaatgttaacgttaattctgatcatggattgaggaatgtataa |
40505873 |
T |
|
| Q |
308 |
atctatgatttagtgcttgttgggtttgattgattgtaggaataggaattaaggaagctgttgaaacagaaaaagcacctgctgctttgggaccatattc |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40505872 |
atctatgatttagtgcttgttgggtttgattgattgtaggaataggaattaaggaagctgttgaaacagaaaaagcacctgctgctttgggaccatattc |
40505773 |
T |
|
| Q |
408 |
tcaagcaaacaaagtca |
424 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40505772 |
tcaagcaaacaaagtca |
40505756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University