View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523_high_15 (Length: 241)
Name: NF5523_high_15
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 20 - 183
Target Start/End: Complemental strand, 35644355 - 35644198
Alignment:
| Q |
20 |
cttgtgtgattcggtatacttattttatttgtcataaaccctcaactaaggttccgacaaggcaaagagcagatctgatcatgatagccaagtggaagaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||| ||||| |||||||||||||||| |||||||| |
|
|
| T |
35644355 |
cttgtgtgattcggtatacttattttatttgtcataaacccacaactaaggtttcgacaaggcgaag--cagatttgatcatgatagccaaatggaagaa |
35644258 |
T |
 |
| Q |
120 |
gagtcgtatgagattaagacgacactttgaagggagtatgtatgcacatgaggtttggaaccat |
183 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35644257 |
gagtcgtataagattaagacgacactttgaagggagtata----cacatgaggtttggaaccat |
35644198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 205 - 240
Target Start/End: Complemental strand, 35644180 - 35644145
Alignment:
| Q |
205 |
acaaaaacaatatactaaaatccgtaaaatataatc |
240 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35644180 |
acaaaaaccatatactaaaatccgtaaaatataatc |
35644145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University