View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523_high_16 (Length: 238)
Name: NF5523_high_16
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 49 - 224
Target Start/End: Original strand, 26164031 - 26164203
Alignment:
| Q |
49 |
ttaatgtcccaattgattatccaagttgatatactactatccaagtagattatctaagaagaagaaaattaactgcaagggcctttaaccaggaagaaga |
148 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26164031 |
ttaatgtcttaattgattatccaagttgatatactactatccaagttgattatccaaga---agaaaattaactgcaagggcctttaaccaagaagaaga |
26164127 |
T |
|
| Q |
149 |
aaaatagaatattgacaaatatacaattgccttgtttggttcattacgggaaaatgaggagagtgaagtaaatatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26164128 |
aaaatagaatattgacaaatatacaattgccttgtttggttcattgcgggaaaatgaggagagtgaagtaaatatt |
26164203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 26182464 - 26182515
Alignment:
| Q |
173 |
aattgccttgtttggttcattacgggaaaatgaggagagtgaagtaaatatt |
224 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26182464 |
aattgcattatttggttcattacgggaaaatgaggagagtgaagtaaatatt |
26182515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University