View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523_high_5 (Length: 352)
Name: NF5523_high_5
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 4e-26; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 216 - 318
Target Start/End: Original strand, 29283425 - 29283524
Alignment:
| Q |
216 |
attatacggtctcgatgatcgattttgatcgaacggttgagatcagtaactaattatagtattctctattttcgactttgtatcataattcaaatacaaa |
315 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||| ||||| |||||| || |||||||| ||||||||||||| |
|
|
| T |
29283425 |
attatacggtcttgatgatcgattttgatcgaacggttgagatcaataactaatcatagcattctttatttttgattttgtatc---attcaaatacaaa |
29283521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 146 - 222
Target Start/End: Original strand, 29283293 - 29283369
Alignment:
| Q |
146 |
tgttgtataaatgcttgtgaaatatgagtatcctcaagttgcttttcatggatttggattcgctgcagtaattatac |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||| ||||| |||| |
|
|
| T |
29283293 |
tgttgtacaaatgcttgtgaaatatgagtatcctcaagttgcatttcatggatctggatttgctgcggtaatgatac |
29283369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 29283148 - 29283197
Alignment:
| Q |
12 |
atcatcatatgatgataatgagttgattaatgatatatcgttctgtcttc |
61 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29283148 |
atcatcatgtgatgataatgagttgattaatgatatatcgttctgtcttc |
29283197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 137
Target Start/End: Original strand, 29283236 - 29283270
Alignment:
| Q |
103 |
actagtcatagatcaatgttgtacaaatgcaccat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29283236 |
actagtcatagatcaatgttgtacaaatgcaccat |
29283270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 103 - 222
Target Start/End: Complemental strand, 6469264 - 6469141
Alignment:
| Q |
103 |
actagtcatagatcaatgttgtacaaatgcaccatnnnnnnnn----tgttgtataaatgcttgtgaaatatgagtatcctcaagttgcttttcatggat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
6469264 |
actagtcatagatcaatgttgtacaaatgcaccataaaaaaaaaaattgttgtacaaatgcttgtgaaatatgagtatcctcaagttgcgtttcatgcat |
6469165 |
T |
 |
| Q |
199 |
ttggattcgctgcagtaattatac |
222 |
Q |
| |
|
|||| || ||||||||||| |||| |
|
|
| T |
6469164 |
ttggttttgctgcagtaatgatac |
6469141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 59
Target Start/End: Complemental strand, 6469745 - 6469698
Alignment:
| Q |
12 |
atcatcatatgatgataatgagttgattaatgatatatcgttctgtct |
59 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
6469745 |
atcatcacatgatgataataagttgatcaatgatatatcgttctgtct |
6469698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University